
You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on Toxin, Toxin Target Database.
Alpha-7 nicotinic cholinergic receptor subunit
Name | Alpha-7 nicotinic cholinergic receptor subunit |
---|---|
Synonyms | Not Available |
Gene Name | CHRNA7 |
Organism | Human |
Amino acid sequence | >lcl|BSEQ0022322|Alpha-7 nicotinic cholinergic receptor subunit ITVLLSLTVFMLLVAEIMPATSDSVPLI |
Number of residues | 28 |
Molecular Weight | 2987.635 |
Theoretical pI | 3.55 |
GO Classification | Processes
Components
|
General Function | Not Available |
Specific Function | Not Available |
Pfam Domain Function |
|
Transmembrane Regions | Not Available |
GenBank Protein ID | Not Available |
UniProtKB ID | Q693P7 |
UniProtKB Entry Name | Q693P7_HUMAN |
Cellular Location | Not Available |
Gene sequence | >lcl|BSEQ0006706|87 bp GGATAACAGTCTTACTCTCTCTTACCGTCTTCATGCTGCTCGTGGCTGAGATCATGCCCG CAACATCCGATTCGGTACCATTGATAG |
GenBank Gene ID | AY641831 |
GeneCard ID | Not Available |
GenAtlas ID | CHRFAM7A |
HGNC ID | Not Available |
Chromosome Location | Not Available |
Locus | Not Available |
References | Not Available |