You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on Toxin, Toxin Target Database.
NameAlpha-7 nicotinic cholinergic receptor subunit
SynonymsNot Available
Gene NameCHRNA7
OrganismHuman
Amino acid sequence
>lcl|BSEQ0022322|Alpha-7 nicotinic cholinergic receptor subunit
ITVLLSLTVFMLLVAEIMPATSDSVPLI
Number of residues28
Molecular Weight2987.635
Theoretical pI3.55
GO Classification
Processes
  • ion transport
Components
  • integral component of membrane
General FunctionNot Available
Specific FunctionNot Available
Pfam Domain Function
Transmembrane RegionsNot Available
GenBank Protein IDNot Available
UniProtKB IDQ693P7
UniProtKB Entry NameQ693P7_HUMAN
Cellular LocationNot Available
Gene sequence
>lcl|BSEQ0006706|87 bp
GGATAACAGTCTTACTCTCTCTTACCGTCTTCATGCTGCTCGTGGCTGAGATCATGCCCG
CAACATCCGATTCGGTACCATTGATAG
GenBank Gene IDAY641831
GeneCard IDNot Available
GenAtlas IDCHRFAM7A
HGNC IDNot Available
Chromosome LocationNot Available
LocusNot Available
ReferencesNot Available