Tmic
You are using an unsupported browser. Please upgrade your browser to a newer version to get the best experience on Toxin, Toxin Target Database.
Name16S RNA
Sequence
>lcl|BSEQ0008414|16S RNA
GCUAAACCUAGCCCCAAACCCACUCCACCUUACUACCAGACAACCUUAGCCAAACCAUUU
ACCCAAAUAAAGUAUAGGCGAUAGAAAUUGAAACCUGGCGCAAUAGAUAUAGUACCGCAA
GGGAAAGAUGAAAAAUUAUAACCAAGCAUAAUAUAGCAAGGACUAACCCCUAUACCUUCU
GCAUAAUGAAUUAACUAGAAAUAACUUUGCAAGGAGAGCCAAAGCUAAGACCCCCGAAAC
CAGACGAGCUACCUAAGAACAGCUAAAAGAGCACACCCGUCUAUGUAGCAAAAUAGUGGG
AAGAUUUAUAGGUAGAGGCGACAAACCUACCGAGCCUGGUGAUAGCUGGUUGUCCAAGAU
AGAAUCUUAGUUCAACUUUAAAUUUGCCCACAGAACCCUCUAAAUCCCCUUGUAAAUUUA
ACUGUUAGUCCAAAGAGGAACAGCUCUUUGGACACUAGGAAAAAACCUUGUAGAGAGAGU
AAAAAAUUUAACACCCAUAGUAGGCCUAAAAGCAGCCACCAAUUAAGAAAGCGUUCAAGC
UCAACACCCACUACCUAAAAAAUCCCAAACAUAUAACUGAACUCCUCACACCCAAUUGGA
CCAAUCUAUCACCCUAUAGAAGAACUAAUGUUAGUAUAAGUAACAUGAAAACAUUCUCCU
CCGCAUAAGCCUGCGUCAGAUUAAAACACUGAACUGACAAUUAACAGCCCAAUAUCUACA
AUCAACCAACAAGUCAUUAUUACCCUCACUGUCAACCCAACACAGGCAUGCUCAUAAGGA
AAGGUUAAAAAAAGUAAAAGGAACUCGGCAAAUCUUACCCCGCCUGUUUACCAAAAACAU
CACCUCUAGCAUCACCAGUAUUAGAGGCACCGCCUGCCCAGUGACACAUGUUUAACGGCC
GCGGUACCCUAACCGUGCAAAGGUAGCAUAAUCACUUGUUCCUUAAAUAGGGACCUGUAU
GAAUGGCUCCACGAGGGUUCAGCUGUCUCUUACUUUUAACCAGUGAAAUUGACCUGCCCG
UGAAGAGGCGGGCAUAACACAGCAAGACGAGAAGACCCUAUGGAGCUUUAAUUUAUUAAU
GCAAACAGUACCUAACAAACCCACAGGUCCUAAACUACCAAACCUGCAUUAAAAAUUUCG
GUUGGGGCGACCUCGGAGCAGAACCCAACCUCCGAGCAGUACAUGCUAAGACUUCACCAG
UCAAAGCGAACUACUAUACUCAAUUGAUCCAAUAACUUGACCAACGGAACAAGUUACCCU
AGGGAUAACAGCGCAAUCCUAUUCUAGAGUCCAUAUCAACAAUAGGGUUUACGACCUCGA
UGUUGGAUCAGGACAUCCCGAUGGUGCAGCCGCUAUUAAAGGUUCGUUUGUUCAACGAUU
AAAGUCCUACGUGAUCUGAGUUCAGACCGGAGUAAUCCAGGUCGGUUUCUAUCUACUUCA
AAUUCCUCCCUGUACGAAAGGACAAGAGAAAUAAGGCCUACUUCACAAAGCGCCUUCCCC
CGUAAAUGAUAUCAUCUCAACUUAGUAUUAUACCCACACCCACCCAAGAACAGGGUUU
Length1558
Mass (Da)496692